DNAStringSet Error Biostrings in R

I posted this same quandary on Biostars but it seems like traffic is low there so I thought I might pose it here.

I am attempting to import a fasta file of sequences into R using Bioconductor's 'Biostrings' package and the 'DNAStringSet' function but I keep getting the same error:

Error in .Call2("new_XString_from_CHARACTER", classname, x, start(solved_SEW),  : 
key 112 (char 'p') not in lookup table

My fasta file ("FileName.fa") is comprised of various length sequences, in the following format:

>GeneNameOne
CAGACACCCATAGATACAGATAGACAGATAGAGAAGACACCACCACACAATGA
>GeneNameTwo
CGCGACATGAACCCATGATAGACGATGAGACCCCACACACACC
...etc

I performed 'grep p FileName.fa' in the Unix terminal, but I received no output.

Does anyone have an idea on what is going on?

Thanks in advance.

Answers


I figured it out. I used 'readDNAStringSet' instead like so:

FileName <- readDNAStringSet("FileName.fa")

And it worked marvelously.

Hope this helps anyone else with similar issues.


Need Your Help

How can I convert BLOB Buffer to Base64 string in Swift?

ios json swift blob alamofire

I store a base64 string as a BLOB in swift but I can't figure out how to turn the blob buffered returned back into a UIImage.

Google Spreadsheets Script Move Row

google-apps-script google-sheets

Just like you can manually drag a row and it'll rearrange the whole sheet when you release it, I want to be able to do this in a script, such as: sheet.moveRow(from, to);